Order now

Charité 2019-nCoV BBQ-650 ValuPanel™ Reagents are now part of the ValuPanel line of detection reagents. ValuPanel Reagents are composed of probes and primers that resolve genetic signatures of different pathogen strains. These signatures target the SARS-CoV-2 virus that causes COVID-19. For Research Use Only. Not for use in diagnostic procedures.

Key benefits

  • Fast delivery: Product in stock ships same or next business day
  • Original source: Berry & Associates, Inventor of BlackBerry™ (BBQ-650™) technology referenced in Charité protocol, is now part of the Biosearch Technologies brand
  • Quality manufacture: All probes are HPLC purified. Oligos are manufactured and shipped from a facility entirely separate from positive control production.

order now in the
new transaction portal

Item Sequence
Charite RdRP_SARSr Pan Sarbeco FAM-BBQ-650 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ650
Charite RdRP_SARSr 2019-nCoV FAM-BBQ-650 Probe FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ650
Charite RdRP_SARSr Forward Primer GTGARATGGTCATGTGTGGCGG
Charite RdRP_SARSr Reverse Primer CARATGTTAAASACACTATTAGCATA
Charite E_Sarbeco FAM-BBQ-650Probe FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ650
Charite E_Sarbeco Forward Primer ACAGGTACGTTAATAGTTAATAGCGT
Charite E_Sarbeco Reverse Primer ATATTGCAGCAGTACGCACACA

Product info

This panel consists of FAM-BBQ-650 probes for use in real-time RT PCR to discriminate SARS-CoV-2 viral strains. This ValuPanel contains probes and primers based on genetic signatures for the following:

  • RdRP- Confirmatory assay
    • Pan Sarbeco-Probe to detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs
    • Probe specific for 2019-nCoV, will not detect SARS-CoV
  • E Sarbeco - First line screening assay

Oligonucleotide sequences were designed by German Center for Infection Research (DZIF) at Charité. All probes are labeled with FAM and BlackBerry (BBQ-650) dyes, and are HPLC purified. Berry & Associates, the inventor of BBQ-650 technology, is now part of the Biosearch Technologies brand.

order now in the
new transaction portal

Resources

Recommended products

PCR reagents* including master mix and enzyme for SARS-CoV-2 assay development are also available

Item name  
sbeadex viral RNA purification kit View product
RapiDxFire qPCR 5X Master Mix glycerol free View product
EpiScript RNase H- Reverse Transcriptase View product

For a complete SARS-CoV-2 Quality Solution, consider the AccuPlex™ SARS-CoV-2 Verification Panel coupled with the AccuPlex™ SARS-CoV-2 Reference Material Kit from LGC SeraCare Life Sciences. The target sequence of interest is packaged into a stable non-infectious, and replication-deficient alphavirus particle and the products contain positive materials directed against the published CDC and WHO consensus sequences and the S gene. Also includes negative materials targeting the human RNase P gene.

What do you require to develop your SARS-CoV-2 assay?

We offer probes and primers specific to Coronavirus as well as enzymes, master mix, and extraction capabilities.

Let’s discuss your needs

Related products

Item name  
2019-nCoV CDC-qualified Probe and Primer Kits for SARS-CoV-2 View product
US CDC 2019-nCoV ValuPanel Reagents* View product
Charité 2019-nCoV BHQ ValuPanel Reagents* View product

 

*For Research Use Only. Not for use in diagnostic procedures.