Looking for oligos? Visit our new oligo and Stellaris dedicated platform at
oligos.biosearchtech.com
Charite E_Sarbeco Forward Primer
You are currently seeing list prices, to see your prices please log in
Charite E_Sarbeco Forward Primer
ACAGGTACGTTAATAGTTAATAGCGT
Added to basket
Access support
Need some support with placing an order, setting up an account, or finding the right protocol?
Contact us