Skip to content Skip to navigation menu
Looking for oligos? Visit our new oligo and Stellaris dedicated platform at oligos.biosearchtech.com
 

Charite E_Sarbeco Reverse Primer

Charite E_Sarbeco Reverse Primer

ATATTGCAGCAGTACGCACACA

Select a delivered amount
TBD
Add to basket to request a quote

Access support

Need some support with placing an order, setting up an account, or finding the right protocol?

Contact us