Learn More about our other offerings:
Biosearch Technologies Oligo Synthesis
|
Lucigen Reagent Components
|
Rapid Genomics Genotyping Solutions
|
SeraCare
ATATTGCAGCAGTACGCACACA
Need some support with placing an order, setting up an account, or finding the right protocol?
Contact us| Europe, Middle East, and Africa | |
|---|---|
| UK | +44 1992 470 757 |
| Germany | +49 30 1663 54600 |
| North America, Latin America | |
| Wisconsin, USA | +1 888 575 9695 |
| Asia Pacific | |
| China | +8621-22509000 |
| Singapore | +65 6734 4800 |